Figures
Abstract
Potential biological control agents for two major rice diseases, sheath blight and bacterial panicle blight, were isolated from rice plants in this study. Rice-associated bacteria (RABs) isolated from rice plants grown in the field were tested for their antagonistic activities against the rice pathogens, Rhizoctonia solani and Burkholderia glumae, which cause sheath blight and bacterial panicle blight, respectively. Twenty-nine RABs were initially screened based on their antagonistic activities against both R. solani and B. glumae. In follow-up retests, 26 RABs of the 29 RABs were confirmed to have antimicrobial activities, but the rest three RABs did not reproduce any observable antagonistic activity against R. solani or B. glumae. According to16S rDNA sequence identity, 12 of the 26 antagonistic RABs were closest to Bacillus amyloliquefaciens, while seven RABs were to B. methylotrophicus and B, subtilis, respectively. The 16S rDNA sequences of the three non-antagonistic RABs were closest to Lysinibacillus sphaericus (RAB1 and RAB12) and Lysinibacillus macroides (RAB5). The five selected RABs showing highest antimicrobial activities (RAB6, RAB9, RAB16, RAB17S, and RAB18) were closest to B. amyloliquefaciens in DNA sequence of 16S rDNA and gyrB, but to B. subtilis in that of recA. These RABs were observed to inhibit the sclerotial germination of R. solani on potato dextrose agar and the lesion development on detached rice leaves by artificial inoculation of R. solani. These antagonistic RABs also significantly suppressed the disease development of sheath blight and bacterial panicle blight in a field condition, suggesting that they can be potential biological control agents for these rice diseases. However, these antagonistic RABs showed diminished disease suppression activities in the repeated field trial conducted in the following year probably due to their reduced antagonistic activities to the pathogens during the long-term storage in -70C, suggesting that development of proper storage methods to maintain antagonistic activity is as crucial as identification of new biological control agents.
Citation: Shrestha BK, Karki HS, Groth DE, Jungkhun N, Ham JH (2016) Biological Control Activities of Rice-Associated Bacillus sp. Strains against Sheath Blight and Bacterial Panicle Blight of Rice. PLoS ONE 11(1): e0146764. https://doi.org/10.1371/journal.pone.0146764
Editor: Adam Driks, Loyola University Chicago, UNITED STATES
Received: December 17, 2014; Accepted: December 22, 2015; Published: January 14, 2016
Copyright: © 2016 Shrestha et al. This is an open access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.
Data Availability: All relevant data are within the paper and its Supporting Information files.
Funding: This study was supported by the USDA NIFA (Hatch Project #: LAB93918 and LAB94203), the Louisiana State University Agricultural Center, the Louisiana Board of Regents (the Research and Development Program: LEQSF(2008-11)-RD-A-02), and the Agricultural Research Development Agency of Thailand. The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.
Competing interests: The authors have declared that no competing interests exist.
Introduction
A diverse range of microorganisms dwell in various parts of a plant, causing detrimental, neutral or beneficial effects on plant health [1–3]. Some of plant-inhabiting microorganisms can suppress plant diseases through competition, predation or antagonism against plant pathogens, or through induction of plant defense systems [4, 5]. Antagonistic bacteria isolated from plant surface, soil and rhizosphere have been extensively used to control major crop diseases caused by various fungal and bacterial diseases [6, 7]. Those microorganisms can be used alone or in combination with other chemical or biological control agents for various crop diseases [1–3, 6, 8, 9] [10, 11].
Sheath blight is one of the most economically important rice diseases worldwide, which is caused by the fungal pathogen Rhizoctonia solani. Typical symptoms of this disease are oval to irregular lesions with grayish inner and dark brown margin colors on rice sheath and leaf blades. R. solani is a soilborne pathogen having a broad host range including rice and soybean. Epidemics of sheath blight occur throughout the temperate and tropical rice-growing regions. High nitrogen rates and plant density provide favorable microclimate conditions for the development of sheath blight during early heading and grain-filling stages [12]. Common practices for the management of sheath blight include crop rotation, fertilizer management, planting disease-tolerant varieties, and fungicide application. However, rice cultivars having vertical (or complete) resistance to the disease are not available to cultivate, and crop rotation will not assure effective management of the disease because the fungus can survive for a long period of time in the form of sclerotia, a primary source of inoculum that overwinters in soil and plant debris. Various fungicides are being used to control the disease [13–15], however, fungicide application increases the cost of cultivation and the risk of the emergence of fungicide-resistant pathogens [16].
Bacterial panicle blight, which is caused by the Gram-negative bacterial pathogens Burkholderia glumae and B. gladioli, is another important rice disease in many rice-growing regions around the world [17–20]. The major symptoms of this disease include panicle discoloration, grain rot, and sterile florets. Prolonged high night-temperatures during the heading and flowering stages favor the outbreaks of bacterial panicle blight [19, 21, 22]. B. glumae, the chief causal organism of bacterial panicle blight [23], is a seed-borne bacterium and produces the yellow-colored phytotoxin, toxoflavin, as a major virulence factor [24]. Despite the economic importance of bacterial panicle blight, there is few control measures for this disease. There is no known complete resistance for this disease and only a few partially resistant varieties are commercially available [25, 26]. Oxolinic acid is the only known commercial chemical agent for controlling this disease [27]. However, this chemical is not registered for agricultural purposes in some countries including the United States [19], and natural occurrence of oxolinic acid-resistant strains limits the usage of this chemical [28].
In this study, rice-associated bacteria (RABs) showing various levels of antagonistic activities against R. solani and B. glumae were isolated and identified based on their DNA sequences of 16S rDNA, gyrA, and recA. Furthermore, in vivo antagonistic activities and disease control efficacies in the rice field for sheath blight and bacterial panicle blight, as well as rice growth promoting activities, were tested with five selected RABs showing highest levels of antimicrobial activities.
Results
Isolation of RAB Strains Showing Antimicrobial Activities against R. solani and B. glumae
Twenty-nine RAB strains (RABs) out of the total 127 RABs tested were initially screened based on their antimicrobial activities against both R. solani and B. glumae. Through repeated follow-up experiments with the 29 RABs, 26 RABs were confirmed to have antagonistic activities, however, the remaining three RABs (RAB1, RAB5 and RAB12) did not show any antifungal or antibacterial activities again (Fig 1). According to the sizes of the inhibition zones, the antibacterial activities of the 26 active RABs were overall less variable than their antifungal activities, except that RAB3 showed a much lower antibacterial activity compared to other antagonistic RABs (Fig 1C and 1D). Across the 26 antagonistic RABs, RAB2S, RAB3, RAB8, RAB13, RAB17R and RAB19 showed relatively lower antifungal activities, while RAB6, RAB9 and RAB17S showed relatively higher antifungal activities against R. solani (Fig 1C).
The bacterial suspension of each RAB was spotted after Burkholderia glumae cells were spread-plated, or a mycelial plug of Rhizoctonia solani was placed on the center of a PDA plate. The plates of dual culture were incubated at 25C for 72 h in the dark. (A) Selected plates of dual culture showing antifungal activities of RABs against R. solani. (B) Selected plates of dual culture showing antibacterial activities of RABs against B. glumae. (C) Antifungal (upper graph) and antibacterial (lower graph) activities of RABs against R. solani and B. glumae, respectively. Each error bar indicates standard deviation from three replications. The letter above each column indicates significant difference from other data with P < 0.0001 based on Tukey’s test and each error bar indicates standard deviation from three replications.
Identification of RABs
In the Ryu’s 3% KOH tests, all the 29 RABs tested were determined to be Gram-positive along with the control bacterium B. subtilis, while B. glumae cells used as the Gram-negative control bacterium exhibited typical mucous thread of genomic DNA (Table 1). BLAST searches of the 16S rDNA sequences against the NCBI database revealed the bacterial species showing the highest sequence identity to each RAB (Table 1). In this approach, 12 of the 26 antagonistic RABs were closest to B. amyloliquefaciens, and seven of the remaining 14 RABs were to B. methyllotrophicus and B. subtilis, respectively (Table 1). The three non-antagonistic RABs were closest to Lysinibacillus sphaericus (RAB1, RAB12) and Lysinibacillus macroides (RAB5) (Table 1). Consistent with the BLAST search results shown in Table 1, all the 26 RABs showing antimicrobial activities were clustered in a same major clade along with B. amyloliquefaciens, B. methylotrophicus and B. subtilis, while the three non-antagonistic RABs (RAB1, RAB5, and RAB12) were clustered as a separate clade along with Lysinibacillus sphaericus (RAB1 and RAB12) or L. xylanilyticus (RAB5) (Fig 2). Among the species of Bacillus included in this cluster analysis, B. anthracis, B. cereus, B. pumilus, and B. licheniformis were grouped as separate clades from the antagonistic RABs, indicating that the RABs in this study are distantly related to these species (Fig 2). However, these species were exhibited to be more closely related to the antagonistic RABs than to the non-antagonistic RABs (Fig 2).
GenBank accession numbers for the sequences obtained from the database are given in parentheses. The tree was generated using neighbor-joining method, and genetic distances were calculated using the Kimura 2-parameter method using MEGA5 [76]. Numbers at nodes indicate percentage of occurrence in 1000 bootstrapping. The bar at the bottom of the tree indicates the scale for genetic distances. Burkholderia glumae 336gr-1 was used as an out-group control.
Biological Activities of Five Selected Antagonistic RABs on R. solani
Five antagonistic RABs (RAB6, RAB9, RAB16, RAB17S, and RAB18) were selected for further characterization in other biological activities on R. solani. All of the selected RABs appeared to be B. amyloliquefaciens according to the phylogenetic analysis of their 16S rDNA (Fig 2) and gyrB (Fig 3A) sequences. However, these five RABs were more closely related to B. subtilis ATCC19217 than to B. amyloliquefaciens G341 in terms of the DNA sequences for recA (Fig 3B), in which only two bases were different between the two bacterial species. Germination of R. solani sclerotia was completely inhibited by the five selected RABs (Fig 4A). In detached leaf assays, all the five selected RABs significantly restricted the development of sheath blight lesions (Fig 4B).
GenBank accession numbers for the sequences obtained from the database are given in parentheses. The tree was generated using neighbor-joining method, and genetic distances were calculated using the Kimura 2-parameter method using MEGA5 [76]. Numbers at nodes indicate percentage of occurrence in 1000 bootstrapping. The bar at the bottom of the tree indicates the scale for genetic distances. Burkholderia glumae 336gr-1 was used as an out-group control.
(A) Inhibition of sclerotial germination by RABs. Overnight cultured sclerotia with RAB inoculum in test tube were grown on PDA media and incubated at 25°C for 72 h. Sclerotia cultured only in LB broth were used as control. Sclerotial germination was inhibited by all RABs inoculum except in the control where the mycelial growth can be observed. (B) Inhibition of sheath blight lesion development by pretreatment of RABs: Examples of detached leaf assay revealing inhibitory activities of RABs against lesion development by R. solani. A detached rice leaf pretreated with a RAB was placed on paper towel moisturized with sterilized ddH2O and a sclerotium of R. solani was inoculated on the center of the detached leaf. Petri-dishes containing the inoculated rice leaves were incubated at 25°C for 7 d with 12 h of light period per day (upper); and Inhibition of sheath blight lesion development by the five selected RABs that showed highest antifungal activities in the dual-culture assay (lower). Each column of the graph represents the average of three replications and the letter above each column indicates significant difference with P < 0.05, which was determined by Tukey’s test.
Biological Control Activities of the Selected Antagonistic RABs
The five RABs selected were further tested for their biological control efficacies on sheath blight and bacterial panicle blight in the field condition. All of the five RABs reduced the symptom development of sheath blight in the susceptible cultivar, Bengal, when applied to the rice 24h prior to the pathogen (R. solani) inoculation (Fig 5A). RAB9 reduced disease development significantly more than other RABs (Fig 5A). Other four RABs also inhibited disease development significantly compared to the water-treated control (Fig 5A). Sheath blight symptoms were not developed in the uninoculated plants (Fig 5A). Similarly, pretreatments of rice with the RABs 24 h prior to the inoculation of B. glumae resulted in reduced development of bacterial panicle blight symptoms on rice panicles (Fig 5B). All the five RABs caused significant levels of reduction in bacterial panicle blight symptom development compared to the water-treated control, but there was no significant difference among the RABs tested (Fig 5B).
(A) Suppression of sheath blight by RABs. R. solani was inoculated 24 h after the treatment of RABs at the tillering stage of rice plants (cv. Bengal). Rice plants treated with water instead of a RAB and those without inoculation of R. solani were included as controls. Disease severity was rated 27 days after inoculation based on a 0 to 9 scale scheme [79]. Each error bar indicates standard error from three replications and the letters above individual columns indicate significant differences with P < 0.05 according to Dunn’s test. (B) Suppression of bacterial panicle blight by RABs. B. glumae was inoculated 24 h after the treatment of RABs at the 30% heading stage of rice plants (cv. Bengal). Rice plants treated with water instead of a RAB and those without inoculation of B. glumae were included as controls. Disease severity on the rice panicles was rated 10 days after inoculation of B. glumae 336gr-1, using a 0 to 9 scale scheme [80]. Each error bar indicates standard error from three replications and the letters above individual columns indicate significant differences with P < 0.05 according to Dunn’s test.
However, the disease suppression activities of the RABs were significantly reduced in the repeated field trial conducted in the following year (S1 Fig). Only RAB6 and RAB9 showed significant reduction of sheath blight in the repeated trial (S1A Fig), and none of the five RABs retained the disease suppression activities on bacterial panicle blight until the following year (S1B Fig). In a retest of antagonistic activity conducted at four years after the first test, the RABs showed substantial reduction in growth inhibition activity against both R. solani and B. glumae, indicating their diminished activities during the long-term storage at -70C (S2 Fig).
Growth-Promoting Activities of the Selected Antagonistic RABs
The growth-promoting activities of the RABs on rice were determined with the bacterial stocks stored at -70C for four years. Rice seeds were treated with each of the five RABs and then grown in the greenhouse for four weeks. The size of rice seedlings was measured and compared based on the length of shoots and roots. As shown in S3 Fig, RAB9 and RAB18 showed a significant growth-promoting activity for roots and shoots, respectively (S3 Fig).
Discussion
In this study, 26 RABs having various antifungal and antibacterial activities against R. solani and B. glumae, respectively, were isolated from rice plants, and all of them were identified to be Bacillus spp. based on their 16S rDNA sequences. Regarding their antagonistic activities against the fungal and bacterial rice pathogens, these RABs can be potential biological agents for both sheath blight and bacterial panicle blight and possibly other plant diseases caused by fungal and bacterial pathogens. Indeed, five RABs showing highest antimicrobial activities (RAB6, RAB9, RAB16, RAB17S and RAB18) were effective in suppressing the development of sheath blight and bacterial panicle blight in the field condition if they were sprayed to rice plants prior to pathogen inoculation.
This study suggests that Bacillus-type bacteria are predominant in rice plants as antagonists against pathogens (Table 1). Bacillus spp. have been predominantly used to control various crop diseases [29] [30]. Recent examples include citrus canker caused by Xanthomonas axonopodis pv. citri [31], bacterial wilt and late blight in tomato caused by Ralstonia solanacearum and Phytophthora infestans, respectively [32–34], bacterial blight in rice caused by Xanthomonas oryzae pv. oryzae [35], and wheat root rot caused by Fusarium graminearum [36]. Specifically, majority of the antagonistic RABs in this study (12 out of 26 RABs) appeared to be B. amyloliquefaciens based on the nucleotide sequences of 16S rDNA and gyrB (Table 1)(Fig 3A), even though this identification is still inconclusive due to the closer similarity of their recA sequences to B. subtilis (Fig 3B). Strains of B. amyloliquefaciens have been reported as a good biological control agent for other crop diseases, including bacterial wilt and powdery mildew of tomato [34, 37], stem rot of canola [38], bacterial wilt of peanut [39], ring rot of apple [40], and bacterial soft rots of vegetables [41].
The observed antagonistic activities of the RABs appeared to be B. amyloliquefaciens are likely caused by antimicrobial secondary metabolites. Strains of B. amyloliquefaciens have been known to produce a variety of antimicrobial compounds. Lipopeptides and cyclic lipopeptides produced by non-ribosomal peptide synthetases (NRPSs), such as surfactin, fengycin, bacillbactin, and bacillomycin D, are thought to be major antimicrobial components of B. amyloliquefaciens [42]. Additional antimicrobial compounds known to be synthesized non-ribosomally by B. amyloliquefaciens include polyketides, such as macrolactin and difficidin, and the dipeptide, bacilysin [43, 44]. Bacteriocins produced by B. amyloliquefaciens, such as subtilosin, amylolysin and amylocyclicin, are also known to suppress phytopathogenic bacteria [45–47]. Nevertheless, it is also possible that direct antimicrobial activities of the RABs may not be solely responsible for their biological control activities against SB and BPB in the field. Instead, induction of plant defense systems by the RABs can be the main mechanism underlying the biological control activities observed in this study. Induction of plant defense systems by B. amyloliquefaciens has been revealed by several research groups [42, 48–51]. Related to this notion, it was reported that B. amyloliquefaciens subsp. plantarum FZB42, an effective commercial biocontrol agent, did not change significantly the rice root microbiome, but could compensate partially the changes in microbial community structure caused by the pathogen, R. solani [52]. More comprehensive and integrated studies, incorporating the expression profiles of rice defense-related genes and the microbial communities surrounding rice plants resulted from the treatment of RABs, would lead to better understanding of the mechanisms underlying the biological control activities of the RABs.
Meanwhile, seven antagonistic RABs appeared to be B. methylotrophicus, a recently defined new species [53], and B. subtilis, respectively, based on their 16S rDNA sequences. Like B. amyloliquefaciens, strains of B. methylotrophicus and B. subtilis have also been reported as effective biological control and/or plant growth promoting agents [53–56]. A recent whole genome sequence analysis revealed the close relatedness between B. amyloliquefaciens subsp. plantarum and B. methylotrophicus [57]. The antagonistic RABs closest to B. methylotrophicus and B. subtilis are also being investigated for the mechanisms underlying their antimicrobial and biological control activities.
All the three RABs that did not show observable antagonistic activities were closest to one of two Lysnibacillus spp., L. sphaericus (RAB1 and RAB12) or L. xylanilyticus (RAB5), in 16S rDNA sequence. At this point, it remains to be tested if these RABs have any beneficial activities to rice plants, such as suppression of pathogens and promotion of plant growth, even though none of them showed significant antimicrobial activity against R. solani and B. glumae in vitro. So far, information about biological control activities of Lysinibacillus spp is relatively limited. A strain of L. fusiformis isolated from citrus roots was shown to reduce the population of viable Ca. L. asiaticus in citrus leaves [58] and some bacteria belonging to this genus have been identified as plant growth-promoting endophytic bacteria [59, 60]. Meanwhile, several strains of Lysinibacillus sp. closest to L. sphaericus and L. xylanilyticus were shown to have antimicrobial activities against foodborne bacterial and fungal pathogens possibly through bacteriocins [61] and some strains of L. sphaericus have toxic activities against the larvae of Culex mosquitoes, which are conferred at least in part by S-layer proteins [62] and Mtx toxins [63]. L. sphaericus was also reported as a potential cellulolytic agent for fermentation of rice straw [64]. It is noteworthy that the binary toxic Bin protein produced by L. sphaericus showed anticancer activities against human cancer cell lines in a recent study [65].
Subjects of further research on the RABs identified in this study include testing of their antagonistic activities against various pathogens causing other important plant (and possibly animal) diseases and identification and characterization of molecular and/or genetic components responsible for the antimicrobial activities of the RABs to elucidate their underlying mechanisms. In addition, significant reduction of antagonistic and biocontrol activities during the long-term storage at -70C was observed with the RABs in this study, indicating the importance of proper preservation of biocontrol agents. Thus, development of optimal formulation methods for long preservation as well as safe and easy application is required for practical utilization of potential biological control agents identified in this study.
Materials and Methods
Isolation of RABs
Leaves of rice plants at the 30% heading stage were collected from the rice field in the LSU AgCenter Rice Research Station at Crowley, Louisiana. The collected leaves were cut into ~ 4 cm-long pieces and subsequently washed by stirring in 500 ml of sterilized ddH2O for 10 min or in 500 ml of 10% bleach for 5 min. The bleach-sterilized leaf pieces were then stirred in sterilized ddH2O for 10 min to remove the remaining bleach. The washed leaf pieces were placed on potato dextrose agar (PDA) plates, making the adaxial side contact to the medium, and incubated at room temperature for 72 h. Bacterial colonies grown out from the leaf samples were transferred to new PDA plates for pure isolation of RABs.
Measurement of RABs’ Antimicrobial Activities against R. solani and B. glumae
To determine antifungal activities of RABs against R. solani, a mycelial plug of R. solani was taken from one-week-old culture of the fungal pathogen on potato dextrose agar (PDA) using a cork borer (5 mm in diameter) and placed on the center of a fresh PDA plate. Each RAB was cultured overnight in L broth (LB) (10 g tryptone, 10 g NaCl and 5 g yeast extract per L) in a shaking incubator at 37C at 190 rpm. The 1.5 ml of each culture was then washed twice with fresh LB and resuspended in 100 μl of LB. Ten μl of the bacterial suspension was spotted on three locations around the mycelial plug on PDA. Observation of antifungal activities and measurement of inhibition zones were conducted 72 h after incubation at 25C.
To determine antibacterial activities of RABs against B. glumae, B. glumae strain 336gr-1 was cultured overnight in LB at 37C and the overnight culture was washed twice with fresh LB. One hundred microliters of the bacterial suspension adjusted to OD600 = 0.1 (ca. 5×107 CFU/ml) was spread-plated on a PDA plate. Bacterial suspensions of RABs were prepared as described above and 10 μl of each sample was spotted on three location of a PDA plate previously spread with B. glumae. Observation of antibacterial activities and measurement of inhibition zones were conducted 72 h after incubation at 25C.
Identification of the Antagonistic RABs
The Ryu’s 3% KOH test [66, 67] was performed to initially categorize RABs into Gram-positive or Gram-negative bacteria. B. glumae and Bacillus subtilis were used as a control representing Gram-negative and Gram-positive bacteria, respectively. For sequencing of 16S rDNA, genomic DNA of each RAB was extracted using a previously described method [68] and 16S rDNA sequence was amplified using the primers fD1 (5’CCGAATTCGTCGACAACAGAGTTTGATCCTGGCTCAG3’) and rD1 (5’CCCGGGATCCAAGCTTAAGGAGGTGATCCAGCC3’) [69]. Each reaction of PCR contained 3 μl of genomic DNA (~ 100 ng/μl), 2.5 μl of 10X PCR buffer, 0.75 μl of 50mM MgCl2, 0.5 μl of 10mM dNTP mix, 1.0 μl of homemade Taq polymerase (~ 1.0U/μl), 1 μl of 10 μM forward (fD1) and reverse (rD1) primers, and 15.25 μl of sterilized ddH2O in a total volume of 25 μl. The PCR program consisted of the initial denaturation at 95°C for 1 min; 35 cycles of 95°C for 2 min, 42°C for 30 sec and 72°C for 4 min; and the final extension at 72°C for 20 min. For sequencing gyrB, primers UP-1 (5’ GAAGTCATCATGACCGTTCTGCAYGCNGGNGGNAARTTYGA 3’) and UP-2r (5’ AGCAGGGTACGGATGTGCGAGCCRTCNACRTCNGCRTCNGTCAT 3’) were used for gyrB gene amplification, and UP-1S (5’ GAAGTCATCATGACCGTTCTGCA 3’) and UP-2Sr (5’ AGCAGGGTACGGATGTGCGAGCC 3’) were used for sequencing [70]. For sequencing recA, primers recA-F (5' TGAGTGATCGTCAGGCAGCCTTTAG 3') and recA-R (5' CYTBRGATAAGARTACCAWGMACCGC 3') were used for both gene amplification and sequencing [71]. Each reaction for PCR has a total volume of 25 μl containing 2 μl of ~100 ng/μl of genomic DNA as a template, 2.5 μl of 10X PCR buffer (Agilent Technologies, Inc., Santa Clara, CA), 0.5 μl of 10 mM dNTPs, 0.2 μl of 5 U/μl of Paq5000 DNA polymerase (Agilent Technologies, Inc., Santa Clara, CA), 1 μl of 10 μM of forward and reverse primers, and 17.8 μl of sterilized ddH2O. The PCR program for both gyrB and recA genes was set to initial denaturation at 95°C for 3 min followed by 30 cycles of 94°C for 1 min, 60°C for 1 min, 72°C for 2 min, and the final extension of 72°C for 10 min.
PCR products were purified using a QuickClean 5M PCR Purification Kit (GenScript, Piscataway, NJ) and sent to Macrogen Inc. (Seoul, Korea) for sequencing. Sequence results were assembled using a software SeqTrace [72], aligned and cured using MUSCLE [73] and Gblocks [74, 75], respectively, and searched against the National Center for Biotechnology Information (NCBI) database to identify the corresponding or homologous sequences, using Basic Local Alignment Search Tool (BLAST). Phylogenetic analysis with the DNA sequence data of 16S rDNA, gyrB and recA was performed with neighbor joining method using MEGA 5 [76].
Evaluation of RABs’ Inhibitory Activities on Sclerotial Germination of R. solani
The effects of RABs on sclerotial germination of R. solani were observed following a previous method [7] with some modifications. Briefly, young and fresh sclerotia collected from mycelia of R. solani grown on PDA were surface-sterilized with 2% sodium hypochlorite solution for 2 min and washed with sterilized ddH2O. The surface-sterilized sclerotia were put in the overnight-grown cultures of RABs (> 1 X 109 CFU/ml) and further incubated in a shaking incubator for 24 h at 25C at 200 rpm. The sclerotia incubated in a RAB culture were then gently taken out and placed on fresh PDA plates. Germination rate of sclerotia was determined after 72 h of incubation at 25C.
Evaluation of the RABs’ Inhibitory Activities on the Lesion Development by R. solani on Detached Rice Leaves
The detached leaf assay to examine the inhibition of sheath blight lesion development by each RAB was performed following a previous method [77] with minor modifications. Briefly, the second leaf from the base was taken from a two-month-old rice plant of the disease susceptible cultivar, Bengal, and cut into ~ 6 cm-long pieces. The leaf pieces were surface-sterilized with 1% sodium hypochlorite solution for 1 min and washed with sterilized ddH2O. The sterilized leaf pieces were then placed on petri plates containing a wet filter paper, and were pressed with sterilized slide glasses to keep the leaves flat during the experiment. Overnight grown RAB culture in LB broth in a shaking incubator at 25C at 200 rpm was washed two times in a fresh LB, and resuspended in sterilized ddH2O, adjusting the RAB concentration to ca. 6×108 CFU/ml. Each RAB cell suspension was spread on leaf surfaces with a sterile cotton swab. A sclerotium collected from the one-week-old mycelia of R. solani was placed on the center of each leaf piece. Three leaf pieces were treated with each RAB for three replications. Leaf pieces without any RAB treatment and those treated with sterilized ddH2O were also included as controls. The petri dishes containing rice leaf pieces placed with a screlotium were incubated at 25C for 7 days with 12 h-light period per day. The relative lesion length on a detached leaf piece was calculated using the following way according to [78]:
Evaluation of the RABs’ Biocontrol Activities on Sheath Blight and Bacterial Panicle Blight
Treatment of rice plants with RABs.
The medium-grain and disease susceptible cultivar, Bengal, was grown in the field of the Rice Research Station (Crowley, Louisiana) in 2012. Approximately 15 rice plants grown in a row were treated with each RAB (or water for negative control) and overall disease severity of each row was recorded. Data of six replications were obtained from each treatment for statistical analysis. Overnight cultures of RAB grown on LB agar were resuspended in deionized water and bacterial suspension of ca. 5 X 107 CFU/ml (OD600 = 0.1) of each RAB was sprayed onto rice panicles until it drips.
Inoculation of rice plants with R. solani.
The inoculum of R. solani was prepared in a mixture of rice husk and grain. Briefly, 600 g of the rice husk/grain mixture (husk 2: grain 1 w/w) were moisturized with 500 ml of water in an 1 L-flask and sterilized at 121C for 20 min. The sterilized mixture in a flask was inoculated with a ca. 16 cm2 PDA plug containing 7 day-old R. solani mycelia, and incubated at 25C for 10 days. After 10 days of incubation the prepared inoculum was mixed with a fresh sterilized rice husk/grain mixture with 1:2 ratio of prepared inoculum and fresh mixture to increase the inoculum volume. After mixing thoroughly, the mixture was spread uniformly on a clean brown paper sheet and covered with a clean plastic sheet at room temperature. After 24 h of incubation at room temperature, the prepared R. solani inoculum was applied to rice plants at the tillering stage by hand sprinkling at 24 h post treatment of RAB. The symptoms were observed 27 days after inoculation (at the milk stage of rice). Disease severity was rated based on relative lesion size with the scale ranges from 0 to 9 [79].
Inoculation of rice plants with B. glumae.
B. glumae 336gr-1 was grown overnight on King’s B agar at 37°C and the bacterial cells were resuspended in deionized water, adjusting the concentration to ~1×108 CFU/ml. The bacterial suspension was sprayed onto rice panicles at the 30% heading stage at 24 h post treatment of each RAB. The symptoms were observed 10 days after inoculation. Disease severity was rated based on discolored area and sterility of panicles with the scale ranges from 0 to 9 [80].
Evaluation of Rice Growth-Promoting Activities of RABs
Rice seeds (cv. Trenasse) were surface-sterilized with 2.5% sodium hypochlorite for 3 min and washed three times with sterile ddH2O. RABs were grown overnight in L broth overnight at 37C in a shaking incubator at 190 rpm. Overnight grown RAB cultures were washed twice with fresh L broth, and resuspended in sterile ddH2O adjusting to OD600 = 0.2 (~ 1 × 107 CFU/ml). The surface-sterilized rice seeds were soaked in the five different RAB suspensions or in sterile ddH2O for control, and incubated for 24 h at room temperature on a shaker. After incubation, four replications per RAB with 10 rice seeds in each replication were grown in a mixture of sterile soil and sand (3:1 ratio) in 4.5 inch-diameter pots in the greenhouse. The length of shoot and root were measured 4 weeks after planting. Shoot length of the rice seedlings was measured from the tip of the plant to its base, and root length was measured from the base to the root tip.
Supporting Information
S1 Fig. Disease suppression by the five RABs measured in the repeated field trial in the following year (2013).
(A) Suppression of sheath blight by pretreatment of RABs 24 h prior to the inoculation of Rhizoctonia solani during the tillering stage of Trenasse. Disease score was recorded based on a 0–9 scale. Different lowercase alphabets indicate significant differences with p < 0.05 according to Dunn’s test. (B) Suppression of bacterial panicle blight by pretreatment of RABs 24 h prior to the inoculation of Burkholderia glumae 336gr-1 at the 30% heading stage of Trenasse. Disease score was recorded based on a 0–9 scale. Different lowercase alphabets indicate significant differences with p < 0.05 according to Dunn’s test.
https://doi.org/10.1371/journal.pone.0146764.s001
(TIF)
S2 Fig. Diminished antagonistic activities of RABs.
(A) Antifungal activities of RABs against Rhizoctonia solani. (B) Antibacterial activities of RABs against Burkholderia glumae. The blue and orange columns indicate the experimental data in 2011 and 2015, respectively. Each error bar indicates standard deviation from three replications.
https://doi.org/10.1371/journal.pone.0146764.s002
(TIF)
S3 Fig. Growth-promoting activity of RABs.
Rice seeds were incubated with individual RABs (or with sterile ddH2O for ‘control’) for 24 h at room temperature in a shaker at 100 rpm. After incubation seeds were dried, sown in a sterilized soil and sand mixture, and grown in the greenhouse. Rice seedlings were measures at 4 weeks after sowing. Different alphabets on the top of each bar indicate significant difference at α = 0.05. Each error bar indicates standard error from four replications.
https://doi.org/10.1371/journal.pone.0146764.s003
(TIF)
Author Contributions
Conceived and designed the experiments: BKS JHH. Performed the experiments: BKS HSK DEG NJ JHH. Analyzed the data: BKS JHH. Contributed reagents/materials/analysis tools: BKS JHH. Wrote the paper: BKS JHH.
References
- 1. Bashar M, Hossain M, Rahman M, Uddin M, Begum M. (2010) Biological control of sheath blight disease of rice by using antagonistic bacteria. Bangl J Sci Ind Res 45:225–32.
- 2. Bashi E, Fokkema NJ. (1977) Environmental-factors limiting growth of Sporobolomyces roseus, an antagonist of Cochliobolus sativus, on wheat leaves. Trans Brit Myco Soc 68:17–25.
- 3. Williamson MA, Fokkema NJ. (1985) Phyllosphere Yeasts Antagonize Penetration from Appressoria and Subsequent Infection of Maize Leaves by Colletotrichum-Graminicola. Neth J Plant Pathol 91(6):265–76.
- 4. Compant S, Duffy B, Nowak J, Clement C, Barka EA. (2005) Use of plant growth-promoting bacteria for biocontrol of plant diseases: principles, mechanisms of action, and future prospects. Appl Environ Microbiol 71(9):4951–9. pmid:16151072
- 5.
Niranjan RS, Shetty HS, Reddy MS. (2006) Plant growth promoting rhizosphere: Potential green alternative for plant productivity. In: Siddiqui Z, editor. PGPR: Biocontrol and biofertilization. Springer Netherlands p. 197–216.
- 6. Kanjanamaneesathian M, Kusonwiriyawong C, Pengnoo A, Nilratana L. (1998) Screening of potential bacterial antagonists for control of sheath blight in rice and development of suitable bacterial formulations for effective application. Australas Plant Path 27(3):198–206.
- 7. Kazempour MN. (2004) Biological control of Rhizoctonia solani, the causal agent of rice sheath blight by antagonistic bacteria in greenhouse and field conditions. Plant Pathol J 3:88–96.
- 8. Paulitz TC, Zhou T, Rankin L. (1992) Selection of rhizosphere bacteria for biological control of Pythium aphanidermatum on hydroponically grown cucumber. Biol Control 2(3):226–37.
- 9. Pinson SRM, Shahjahan AKM, Rush MC, Groth DE. (2010) Bacterial panicle blight resistance QTLs in rice and their association with other disease resistance loci and heading date. Crop Science 50(4):1287–97.
- 10. Datnoff LE, Nemec S, Pernezny K. (1995) Biological control of Fusarium crown and root rot of tomato in Florida using Trichoderma harzianum and Glomus intraradices. Bio Control 5:427–31.
- 11. Duffy BK, Weller DM. (1995) Use of Gaeumannomyces graminis var graminis alone and in combination with fluorescent Pseudomonas spp. to suppress take-all of wheat. Plant Dis 79(9):907–11.
- 12. Lee FN, Rush MC. (1983) Rice sheath blight: a major rice disease. Plant Dis 67:829–32.
- 13. Groth DE. (2005) Azoxystrobin rate and timing effects on rice sheath blight incidence and severity and rice grain and milling yields. Plant Dis 89:1171–4.
- 14. Miah SA, Shahjahan AKM, Sharma NR, Ahmed HU. (1994) Field-evaluation of fungicides for rice sheath blight control. Bangl J Botany 23(2):239–44.
- 15. Araki F, Yabutani K. (1993) Development of a systemic fungicide, Flutolanil. J Pesti Sci 18(2):S69–S77.
- 16. Staub T. (1991) Fungicide resistance: practical experience with antiresistance strategies and the role of integrated use. Annu Rev Phytopathol 29:421–42. pmid:18479197
- 17. Shahjahan AKM, Rush MC, Groth D, Clark CA. (2000) Panicle blight. Rice J 15:26–9.
- 18. Ham JH, Groth D. (2011) Bacterial panicle blight, an emerging rice disease. Louisiana Agriculture 2011:16–7.
- 19. Nandakumar R, Shahjahan AKM, Yuan XL, Dickstein ER, Groth DE, Clark CA, et al. (2009) Burkholderia glumae and B. gladioli cause bacterial panicle blight in rice in the southern United States. Plant Dis 93(9):896–905.
- 20. Goto T, Nishiyama K, Ohata K. (1987) Bacteria causing grain rot of rice. Ann Phytopathol Soc Jpn 53:141–9.
- 21. Trung HM, Van NV, Vien NV, Lam DT, Lien M. (1993) Occurrence of rice grain rot disease in Vietnam. International Rice Research Notes 18(3).
- 22. Tsushima S. (1996) Epidemiology of bacterial grain rot of rice caused by Pseudomonas glumae. Jarq-Japan Agricultural Research Quarterly. 30(2):85–9.
- 23. Dassanayake M, Oh DH, Haas JS, Hernandez A, Hong H, Ali S, et al. (2011) The genome of the extremophile crucifer Thellungiella parvula. Nature genetics. 2011;43(9):913–8. pmid:21822265
- 24. Sato Z, Koiso Y, Iwasaki S, Matsuda I, Shirata A. (1989) Toxins produced by Pseudomonas glumae. Ann Phytopathol Soc Jpn 55(3):353–6.
- 25. Groth DE, Linscombe SD, Sha X. (2007) Registration of two disease-resistant germplasm lines of rice. J Plant Regist 1:63–4.
- 26. Sha X, Linscombe SD, Groth D, Bond JA, White LM, Chu QR, et al. (2006) Registration of 'Jupiter' rice. Crop Science 46:1811–2.
- 27. Hikichi Y. (1993) Mode of action of oxolinic acid against bacterial seedling rot of rice caused by Pseudomonas glumae. 1. Relationship between population dynamics of P. glumae on seedlings of rice and disease severity of bacterial seedling rot of rice Ann Phytopathol Soc Jpn 59:441–6.
- 28. Hikichi Y, Tsujiguchi K, Maeda Y, Okuno T. (2001) Development of increased oxolinic acid-resistance in Burkholderia glumae. J Gen Plant Pathol 67:58–62.
- 29. Perez-Garcia A, Romero D, de Vicente A. (2011) Plant protection and growth stimulation by microorganisms: biotechnological applications of Bacilli in agriculture. Curr Opi Biotech 22(2):187–93.
- 30. Jacobsen BJ, Zidack NK, Larson BJ. (2004) The role of bacillus-based biological control agents in integrated pest management systems: plant diseases. Phytopathology 94(11):1272–5. pmid:18944466
- 31. Huang TP, Tzeng DD, Wong AC, Chen CH, Lu KM, Lee YH, et al. (2012) DNA polymorphisms and biocontrol of Bacillus antagonistic to citrus bacterial canker with indication of the interference of phyllosphere biofilms. PLoS One 7(7):e42124. pmid:22848728
- 32. Chen Y, Yan F, Chai Y, Liu H, Kolter R, Losick R, et al. (2013) Biocontrol of tomato wilt disease by Bacillus subtilis isolates from natural environments depends on conserved genes mediating biofilm formation. Environ Microbiol 15(3):848–64. pmid:22934631
- 33. Kabir L, Kim SW, Kim YS, Lee YS. (2103) Biocontrol of late blight and plant growth promotion in tomato using rhizobacterial isolates. J Microbiol Biotechn 23(7):897–904.
- 34. Tan SY, Dong Y, Liao HP, Huang JF, Song S, Xu YC, et al. (2013) Antagonistic bacterium Bacillus amyloliquefaciens induces resistance and controls the bacterial wilt of tomato. Pest Management Science 69(11):1245–52. pmid:23519834
- 35. Chithrashree , Udayashankar AC, Nayaka SC, Reddy MS, Srinivas C. (2011) Plant growth-promoting rhizobacteria mediate induced systemic resistance in rice against bacterial leaf blight caused by Xanthomonas oryzae pv. oryzae. Biol Control 59(2):114–22.
- 36. Moussa TAA, Almaghrabi OA, Abdel-Moneim TS. (2013) Biological control of the wheat root rot caused by Fusarium graminearum using some PGPR strains in Saudi Arabia. Ann Appl Biol 163(1):72–81.
- 37. Yamamoto S, Shiraishi S, Kawagoe Y, Mochizuki M, Suzuki S. (2015) Impact of Bacillus amyloliquefaciens S13-3 on control of bacterial wilt and powdery mildew in tomato. Pest Manag Sci 71(5): 722–27. pmid:24889125
- 38. Wu Y, Yuan J, Raza W, Shen Q, Huang Q. (2014) Biocontrol traits and antagonistic potential of Bacillus amyloliquefaciens strain NJZJSB3 against Sclerotinia sclerotiorum, a causal agent of canola stem rot. J Microbiol Biotechnol 24(10):1327–36. pmid:24861342
- 39. Wang X, Liang G. (2014) Control efficacy of an endophytic Bacillus amyloliquefaciens strain BZ6-1 against peanut bacterial wilt, Ralstonia solanacearum. BioMed Res International 2014:465435.
- 40. Li Y, Han LR, Zhang Y, Fu X, Chen X, Zhang L, et al. (2013) Biological control of apple ring rot on fruit by Bacillus amyloliquefaciens 9001. Plant Pathol J 29(2):168–73. pmid:25288943
- 41. Zhao Y, Li P, Huang K, Wang Y, Hu H, Sun Y. (2013) Control of postharvest soft rot caused by Erwinia carotovora of vegetables by a strain of Bacillus amyloliquefaciens and its potential modes of action. World J Microbiol Biotechnol 29(3):411–20. pmid:23117674
- 42. Chowdhury SP, Uhl J, Grosch R, Alqueres S, Pittroff S, Dietel K, et al. (2015) Cyclic lipopeptides of Bacillus amyloliquefaciens subsp. plantarum colonizing the lettuce rhizosphere enhance plant defence responses towards the bottom rot pathogen Rhizoctonia solani. Mol Plant-Microbe Interac 28(9): 984–95.
- 43. Chen XH, Scholz R, Borriss M, Junge H, Mogel G, Kunz S, et al. (2009) Difficidin and bacilysin produced by plant-associated Bacillus amyloliquefaciens are efficient in controlling fire blight disease. J Biotechnol 140(1–2):38–44. pmid:19061923
- 44. Schneider K, Chen XH, Vater J, Franke P, Nicholson G, Borriss R, et al. (2007) Macrolactin is the polyketide biosynthesis product of the pks2 cluster of Bacillus amyloliquefaciens FZB42. J Nat Prod 70(9):1417–23. pmid:17844999
- 45. Scholz R, Vater J, Budiharjo A, Wang Z, He Y, Dietel K, et al. (2014) Amylocyclicin, a novel circular bacteriocin produced by Bacillus amyloliquefaciens FZB42. J Bacteriol 196(10):1842–52. pmid:24610713
- 46. Arguelles Arias A, Ongena M, Devreese B, Terrak M, Joris B, Fickers P. (2013) Characterization of amylolysin, a novel lantibiotic from Bacillus amyloliquefaciens GA1. PLoS One 8(12):e83037. pmid:24349428
- 47. Liu Q, Gao G, Xu H, Qiao M. (2012) Identification of the bacteriocin subtilosin A and loss of purL results in its high-level production in Bacillus amyloliquefaciens. Res Microbiol 163(6–7):470–8. pmid:22677773
- 48. Kloepper JW, Ryu CM, Zhang S. (2004) Induced systemic resistance and promotion of plant growth by Bacillus spp. Phytopathology 94(11):1259–66. pmid:18944464
- 49. Wang S, Wu H, Qiao J, Ma L, Liu J, Xia Y, et al. (2009) Molecular mechanism of plant growth promotion and induced systemic resistance to tobacco mosaic virus by Bacillus spp. J Microbiol Biotechnol 19(10):1250–8. pmid:19884788
- 50. Sarosh BR, Danielsson J, Meijer J. (2009) Transcript profiling of oilseed rape (Brassica napus) primed for biocontrol differentiate genes involved in microbial interactions with beneficial Bacillus amyloliquefaciens from pathogenic Botrytis cinerea. Plant Mol Biol 70(1–2):31–45. pmid:19184461
- 51. Ongena M, Jourdan E, Adam A, Paquot M, Brans A, Joris B, et al. (2007) Surfactin and fengycin lipopeptides of Bacillus subtilis as elicitors of induced systemic resistance in plants. Environ Microbiol 9(4):1084–90. pmid:17359279
- 52. Chowdhury SP, Hartmann A, Gao X, Borriss R. (2015) Biocontrol mechanism by root-associated Bacillus amyloliquefaciens FZB42—a review. Front Microbiol 6:780. pmid:26284057
- 53. Madhaiyan M, Poonguzhali S, Kwon SW, Sa TM. (2010) Bacillus methylotrophicus sp. nov., a methanol-utilizing, plant-growth-promoting bacterium isolated from rice rhizosphere soil. Intern J Syst Evol Microbiol 60(Pt 10):2490–5.
- 54. Peng J, Zhang X, Xu X, He F, Qi S. (2013) Diversity and chemical defense role of culturable non-actinobacterial bacteria isolated from the South China Sea gorgonians. J Microbiol Biotechnol 23(4):437–43. pmid:23568196
- 55. Ma L, Cao YH, Cheng MH, Huang Y, Mo MH, Wang Y, et al. (2013) Phylogenetic diversity of bacterial endophytes of Panax notoginseng with antagonistic characteristics towards pathogens of root-rot disease complex. Antonie Van Leeuwenhoek 103(2):299–312. pmid:22987248
- 56. Peng D, Li S, Wang J, Chen C, Zhou M. (2014) Integrated biological and chemical control of rice sheath blight by Bacillus subtilis NJ-18 and jinggangmycin. Pest Manag Sci 70(2):258–63. pmid:23564744
- 57. Dunlap CA, Kim SJ, Kwon SW, Rooney AP. (2015) Phylogenomic analysis shows that Bacillus amyloliquefaciens subsp plantarum is a later heterotypic synonym of Bacillus methylotrophicus. Intern J Syst Evol Microbiol 65:2104–9.
- 58. Trivedi P, Spann T, Wang N. (2011) Isolation and characterization of beneficial bacteria associated with citrus roots in Florida. Micro Ecol 62(2):324–36.
- 59. Souza SA, Xavier AA, Costa MR, Cardoso AM, Pereira MC, Nietsche S. (2013) Endophytic bacterial diversity in banana 'Prata Ana' (Musa spp.) roots. Genet Mol Biol 36(2):252–64. pmid:23885208
- 60. Vendan RT, Yu YJ, Lee SH, Rhee YH. (2010) Diversity of endophytic bacteria in ginseng and their potential for plant growth promotion. J Microbiol 48(5):559–65. pmid:21046332
- 61. Ahmad V, Iqbal AN, Haseeb M, Khan MS. (2014) Antimicrobial potential of bacteriocin producing Lysinibacillus jx416856 against foodborne bacterial and fungal pathogens, isolated from fruits and vegetable waste. Anaerobe 27:87–95. pmid:24735603
- 62. Allievi MC, Palomino MM, Prado Acosta M, Lanati L, Ruzal SM, Sanchez-Rivas C. (2014) Contribution of S-Layer proteins to the mosquitocidal activity of Lysinibacillus sphaericus. PLoS One. 9(10):e111114. pmid:25354162
- 63. Wirth MC, Berry C, Walton WE, Federici BA. (2014) Mtx toxins from Lysinibacillus sphaericus enhance mosquitocidal cry-toxin activity and suppress cry-resistance in Culex quinquefasciatus. J Invert Pathol 115:62–7.
- 64. Gupta P, Parkhey P. (2014) A two-step process for efficient enzymatic saccharification of rice straw. Bioresource Technol 173:207–15.
- 65. Luo W, Liu C, Zhang R, He J, Han B. (2014) Anticancer activity of binary toxins from Lysinibacillus sphaericus IAB872 against human lung cancer cell line A549. Natural Product Comm 9(1):107–10.
- 66. Ryu E. (1940) A simple method of differentiation between Gram-positive and Gram-negative organisms without staining. Kitasato Arch Exp Med 17:58–63.
- 67. Suslow TV, Schroth MN, Isaka M. (1982) Application of a rapid method for Gram differentiation of plant pathogenic and saprophytic bacteria without staining. Phytopathology 72(7):917–8.
- 68. Pospiech A, Neumann B. (1995) A versatile quick-prep of genomic DNA from Gram-positive bacteria. Trends in Genetics 11(6):217–8. pmid:7638902
- 69. Weisburg WG, Barns SM, Pelletier DA, Lane DJ. (1991) 16S ribosomal DNA amplification for phylogenetic study. J Bacteriol 173(2):697–703. pmid:1987160
- 70. Yamamoto S, Harayama S. (1995) PCR amplification and direct sequencing of gyrB genes with universal primers and their application to the detection and taxonomic analysis of Pseudomonas putida strains. Appl Env Microbiol 61(3):1104–9.
- 71. Lee HA, Kim JH. (2012) Isolation of Bacillus amyloliquefaciens strains with antifungal activities from Meju. Preven Nut Food Sci 17(1):64.
- 72. Stucky BJ. (2012) SeqTrace: a graphical tool for rapidly processing DNA sequencing chromatograms. J Biomol Tech 23(3):90–3. pmid:22942788
- 73. Edgar RC. (2004) MUSCLE: multiple sequence alignment with high accuracy and high throughput. Nucleic Acids Res 32(5):1792–7. pmid:15034147
- 74. Castresana J. (2000) Selection of conserved blocks from multiple alignments for their use in phylogenetic analysis. Mol Biol Evol 17(4):540–52. pmid:10742046
- 75. Dereeper A, Guignon V, Blanc G, Audic S, Buffet S, Chevenet F, et al. (2008) Phylogeny.fr: robust phylogenetic analysis for the non-specialist. Nucleic Acids Res 36(Web Server issue):W465–9. pmid:18424797
- 76. Tamura K, Peterson D, Peterson N, Stecher G, Nei M, Kumar S. (2011) MEGA5: molecular evolutionary genetics analysis using maximum likelihood, evolutionary distance, and maximum parsimony methods. Mol Biol Evol 28(10):2731–9. pmid:21546353
- 77. Guleria S, Aggarwal R, Thind TS, Sharma TR. (2007) Morphological and pathological variability in rice isolates of Rhizoctonia solani and molecular analysis of their genetic variability. J Phytopathol 155(11–12):654–61.
- 78.
Kumar KVK, Reddy M, Kloepper J, Groth D, Miller M, Sudini H, et al. (2009) In-vitro efficacy of various rhizobacterial isolates against Rhizoctonia solani, the causal agent of rice sheath blight disease. In: Reddy MS, Desai S, Sayyed RZ, Rao VK, Sarma YR, Reddy BC, et al., editors. Plant growth promotion by rhizobacteria for sustainable agriculture. India: Scientific Publishers.
- 79.
Rice INfGEo, Institute IRR. (1996) Standard Evaluation System for Rice: International Rice Research Institute.
- 80. Karki HS, Barphagha IK, Ham JH. (2102) A conserved two-component regulatory system, PidS/PidR, globally regulates pigmentation and virulence-related phenotypes of Burkholderia glumae. Mol Plant Pathol 13(7):785–94. pmid:22364153